-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep2Bac
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 7100
- Total vector size (bp) 10700
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameXPC
-
Alt namexeroderma pigmentosum, complementation group C
-
Alt nameXP3
-
Alt nameRAD4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3600
-
MutationQ475K polymorphism
-
GenBank IDNM_004628.4
-
Entrez GeneXPC (a.k.a. RAD4, XP3, XPCC, p125)
- Promoter Pp10
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer p2Bac-F (ggacctttaattcaacccaacac)
- 3′ sequencing primer BGH_rev (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2Bac.XPC was a gift from Aziz Sancar (Addgene plasmid # 39204 ; http://n2t.net/addgene:39204 ; RRID:Addgene_39204) -
For your References section:
Overproduction, purification, and characterization of the XPC subunit of the human DNA repair excision nuclease. Reardon JT, Mu D, Sancar A. J Biol Chem. 1996 Aug 9;271(32):19451-6. 10.1074/jbc.271.32.19451 PubMed 8702634
Map uploaded by the depositor.