Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p2Bac.XPC
(Plasmid #39204)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39204 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p2Bac
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 7100
  • Total vector size (bp) 10700
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    XPC
  • Alt name
    xeroderma pigmentosum, complementation group C
  • Alt name
    XP3
  • Alt name
    RAD4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3600
  • Mutation
    Q475K polymorphism
  • GenBank ID
    NM_004628.4
  • Entrez Gene
    XPC (a.k.a. RAD4, XP3, XPCC, p125)
  • Promoter Pp10

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer p2Bac-F (ggacctttaattcaacccaacac)
  • 3′ sequencing primer BGH_rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2Bac.XPC was a gift from Aziz Sancar (Addgene plasmid # 39204 ; http://n2t.net/addgene:39204 ; RRID:Addgene_39204)
  • For your References section:

    Overproduction, purification, and characterization of the XPC subunit of the human DNA repair excision nuclease. Reardon JT, Mu D, Sancar A. J Biol Chem. 1996 Aug 9;271(32):19451-6. 10.1074/jbc.271.32.19451 PubMed 8702634