pFB-CT10HF-LIC
(Plasmid #39191)

• Purpose: (Empty Backbone) SGC Baculovirus transfer vector with C-terminal His tag and FLAG tag, preceded by a TEV protease cleavage site. Includes sites for LIC cloning, and SacB gene for negative selection
• Depositing Lab: Nicola Burgess-Brown
• Publication: SGC+year (unpublished)

Backbone

• Vector backbone: pFB-CT10HF-LIC
• Backbone manufacturer: SGC
• Vector type: Baculovirus
• Tag / Fusion Protein:
  • TEV-His-FLAG (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Mach1
• Growth instructions: Transform purified plasmid in DH10Bac to generate recombinant bacmid DNA
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: none
• Promoter: polyhedrin

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: fBac-1 (5'-TATTCATACCGTCCCACCA-3')
• 3′ sequencing primer: fBac-2 (5'-GGGAGGTTTTTTAAAGCAAGTAAA-3')

Resource Information

• Supplemental Documents:
  • Vector Information Sheet
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: GATTGGAAGTAGAGGTTCTCTGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector.