YIPlac204TKC-E2-Crimson-HDEL
(Plasmid #38771)

• Depositing Lab: Benjamin Glick
• Publication: Strack et al Biochemistry. 2009 Sep 8;48(35):8279-81.

Backbone

• Vector backbone: YIPlac204TKC-DsRed-HDEL (Addgene Plasmid #21770)
• Backbone manufacturer: Glick Lab
• Backbone size w/o insert (bp): 4313
• Total vector size (bp): 4988
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: E2-Crimson
• Alt name: Modified DsRed-Express2
• Species: Synthetic
• Insert Size (bp): 675
• Promoter: TPI1
• Tags / Fusion Proteins:
  • Pre-Kar2 (N terminal on backbone)
  • Linker peptide and yeast ER retention signal sequence (THGMDELYK + HDEL) (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: NotI (destroyed during cloning)
• 5′ sequencing primer: CTACAAAAAACACATACATAAACT
• 3′ sequencing primer: M13_reverse

Resource Information

• Supplemental Documents:
  • YIplac204-TKC-E2-Crimson-HDEL Snapgene File
• A portion of this plasmid was derived from a plasmid made by: Rita Strack

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector for targeting E2-Crimson to the ER in yeast cells.

Linearize with EcoRV to integrate at TRP

Substitutions in E2-Crimson relative to DsRed-Express2 are: E32V, Q66F, V71A, V73I, K83L, L85Q, F118L, L150N, I161N, K163M, V175C, Y193H, S197Y