pMXs-puro GFP-p62 L343A
(Plasmid
#38279)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-puro
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 6878
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSequestosome-1
-
Alt namep62
-
Alt nameSqstm1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1300
-
Mutationchanged L343A
-
GenBank IDU57413
-
Entrez GeneSqstm1 (a.k.a. A170, OSF-6, Osi, STAP, STONE14, p62)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer AAAATTAGTCAGCCATGGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byp62 cDNA was provied by Dr. Masaaki Komatsu (Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ichimura et al., JBC 2008 283, 22847
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-puro GFP-p62 L343A was a gift from Noboru Mizushima (Addgene plasmid # 38279 ; http://n2t.net/addgene:38279 ; RRID:Addgene_38279) -
For your References section:
p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. Itakura E, Mizushima N. J Cell Biol. 2011 Jan 10;192(1):17-27. 10.1083/jcb.201009067 PubMed 21220506
Map uploaded by the depositor.