Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMXs-puro GFP-p62 L343A
(Plasmid #38279)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38279 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs-puro
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 6878
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sequestosome-1
  • Alt name
    p62
  • Alt name
    Sqstm1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1300
  • Mutation
    changed L343A
  • GenBank ID
    U57413
  • Entrez Gene
    Sqstm1 (a.k.a. A170, OSF-6, Osi, STAP, STONE14, p62)
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer AAAATTAGTCAGCCATGGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    p62 cDNA was provied by Dr. Masaaki Komatsu (Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Ichimura et al., JBC 2008 283, 22847

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-puro GFP-p62 L343A was a gift from Noboru Mizushima (Addgene plasmid # 38279 ; http://n2t.net/addgene:38279 ; RRID:Addgene_38279)
  • For your References section:

    p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. Itakura E, Mizushima N. J Cell Biol. 2011 Jan 10;192(1):17-27. 10.1083/jcb.201009067 PubMed 21220506