pMXs-puro GFP-b5 ER
(Plasmid
#38274)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMXs-puro
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 6878
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCytochrome b5
-
Alt nameCyb5a
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)123
-
MutationCyb5a Tranmembrane region from 95 to 134 amino acids residues
-
GenBank IDAF007107
-
Entrez GeneCyb5a (a.k.a. Cyb5)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer AAAATTAGTCAGCCATGGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA cDNA of rat cytochrome b5 provided by K. Mihara, Kyushu University, Fukuoka, Japan
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-puro GFP-b5 ER was a gift from Noboru Mizushima (Addgene plasmid # 38274 ; http://n2t.net/addgene:38274 ; RRID:Addgene_38274) -
For your References section:
Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Itakura E, Mizushima N. Autophagy. 2010 Aug;6(6):764-76. 10.4161/auto.6.6.12709 PubMed 20639694
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/98/11/629c5578-c580-11e1-b3ea-003048dd6500.pdf.940x940_q85_autocrop.png)