pMXs-puro HA-WIPI-1
(Plasmid #38273)

• Depositing Lab: Noboru Mizushima
• Publication: Itakura et al Autophagy. 2010 Aug;6(6):764-76.

Backbone

• Vector backbone: pMXs-puro
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 6878
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: WD repeat domain phosphoinositide-interacting protein 1
• Alt name: WIPI-1
• Alt name: WIPI49
• Species: H. sapiens (human)
• Insert Size (bp): 1300
• GenBank ID: AK000917
• Entrez Gene: WIPI1 (a.k.a. ATG18, ATG18A, WIPI49)
• Tag / Fusion Protein:
  • 3xHA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CAGCCCTCACTCCTTCTCTAG
• 3′ sequencing primer: AAAATTAGTCAGCCATGGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry