pMXs-IP spGFP-ERGIC53
(Plasmid #38270)

• Depositing Lab: Noboru Mizushima
• Publication: Itakura et al Autophagy. 2010 Aug;6(6):764-76.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5800
• Total vector size (bp): 6800
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ERGIC-53
• Alt name: ER-Golgi intermediate compartment 53 kDa protein
• Species: H. sapiens (human)
• Insert Size (bp): 1500
• Mutation: deleted signal peptide (1-30 amino acids)
• GenBank ID: U09716
• Entrez Gene: LMAN1 (a.k.a. ERGIC-53, ERGIC53, F5F8D, FMFD1, MCFD1, MR60, gp58)
• Tag / Fusion Protein:
  • EGFP with Calreticulin signal peptide at N-terminal (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA
• 3′ sequencing primer: GAGGAACTGCTTCCTTCACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ORFeome Collaboration clone, on13634
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry