Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMXs-puro HA-Atg14*dCC
(Plasmid #38266)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38266 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs-puro
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 6878
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    autophagy related genes 14
  • Alt name
    Atg14
  • Alt name
    Atg14L
  • Alt name
    KIAA0831
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1137
  • Mutation
    changed A618T, A621T, C624A and T627C for siRNA resistance and lacks coiled-coil domain (71-184 amino acid residues)
  • GenBank ID
    AK131251
  • Entrez Gene
    ATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
  • Promoter LTR
  • Tag / Fusion Protein
    • 3xHA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
  • 3′ sequencing primer AAAATTAGTCAGCCATGGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FLJ16178, Obtained from the department of biotechnology, National Institute of Technology and Evaluation, Tokyo, Japan

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-puro HA-Atg14*dCC was a gift from Noboru Mizushima (Addgene plasmid # 38266 ; http://n2t.net/addgene:38266 ; RRID:Addgene_38266)
  • For your References section:

    Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Itakura E, Kishi C, Inoue K, Mizushima N. Mol Biol Cell. 2008 Dec . 19(12):5360-72. 10.1091/mbc.e08-01-0080 PubMed 18843052