pMXs-IP GFP-Atg14
(Plasmid #38264)

• Depositing Lab: Noboru Mizushima
• Publication: Itakura et al Mol Biol Cell. 2008 Dec . 19(12):5360-72.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5800
• Total vector size (bp): 6800
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: autophagy related genes 14
• Alt name: Atg14
• Alt name: Atg14L
• Alt name: KIAA0831
• Species: H. sapiens (human)
• Insert Size (bp): 1400
• GenBank ID: AK131251
• Entrez Gene: ATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
• Promoter: LTR
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA
• 3′ sequencing primer: GAGGAACTGCTTCCTTCACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: FLJ16178, Obtained from the department of biotechnology, National Institute of Technology and Evaluation, Tokyo, Japan
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry