pMXs-IP GFP-Omp25
(Plasmid #38249)

• Depositing Lab: Noboru Mizushima
• Publication: Yoshii et al J Biol Chem. 2011 Jun 3;286(22):19630-40. Epub 2011 Mar 18.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5800
• Total vector size (bp): 6700
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Omp25
• Alt name: norvegicus synaptojanin 2 binding protein
• Alt name: Synj2bp
• Species: R. norvegicus (rat)
• Insert Size (bp): 111
• Mutation: plasmid contains AA109-145 of rat Omp25/Synj2bp
• GenBank ID: NM_022599
• Entrez Gene: Synj2bp (a.k.a. Omp25)
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: aaggaaaaaagcggccgcaccatggtgagcaaggg
• 3′ sequencing primer: aaggaaaaaagcggccgctcagagctgctttcggtatctc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr.Katsuyoshi Mihara (Kyushu University)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry