pMXs-IP HA-Parkin
(Plasmid #38248)

• Depositing Lab: Noboru Mizushima
• Publication: Yoshii et al J Biol Chem. 2011 Jun 3;286(22):19630-40. Epub 2011 Mar 18.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5800
• Total vector size (bp): 7300
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Parkin
• Species: H. sapiens (human)
• Insert Size (bp): 1398
• GenBank ID: NM_004562
• Entrez Gene: PRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: aaggaaaaaagcggccgcgtaccatggcttacccatacga
• 3′ sequencing primer: aaggaaaaaagcggccgcctacacgtcgaaccagtggtc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Drs.Noriyuki Matsuda & Keiji Tanaka (Tokyo Metropolitan Institute of Medical Science)
• Articles Citing this Plasmid:
  • 12 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry