pIS1-Vim/Actb5UTR-renilla
(Plasmid #38238)

• Depositing Lab: David Sabatini
• Publication: Thoreen et al Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083.

Backbone

• Vector backbone: pIS1
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 1000
• Modifications to backbone: Vector promoter was replaced with genomic mouse Vim promoter (1000 nt of predicted transcriptional start site).
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Vim promoter with Actb 5UTR/Renilla
• Alt name: Vim
• Alt name: Actb
• Species: M. musculus (mouse)
• Insert Size (bp): 1000
• Mutation: Actb promoter (1000 nt upstream) and 5' UTR was replaced with the Vim promoter and first 30 nt of Actb 5' UTR
• Entrez Gene: Vim
• Entrez Gene: Actb (a.k.a. Actx, E430023M04Rik, beta-actin)
• Promoter: Endogenous Vim

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nco1 (not destroyed)
• 3′ cloning site: Nhe1 (not destroyed)
• 5′ sequencing primer: gggctcgctgggtcctaggct
• 3′ sequencing primer: CATCCGTTTCCTTTGTTCTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector originally contained the mouse Actb 5' UTR followed by the renilla luciferase ORF. In the current version, the promoter and first 30 nt of the 5' UTR have been replaced by the mouse Vim promoter and first 30 nt of the Vim 5' UTR, respectively.