pIS1-Eef25UTR-renilla
(Plasmid #38235)

• Depositing Lab: David Sabatini
• Publication: Thoreen et al Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083.

Backbone

• Vector backbone: pIS1
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 5000
• Modifications to backbone: Removed vector promoter and replaced with genomic promoter for mouse Eef2.
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Eef2 5'UTR / Renilla
• Alt name: Eef2
• Species: M. musculus (mouse)
• Insert Size (bp): 2000
• Mutation: Eef2 5' UTR fused to renilla ORF
• Entrez Gene: Eef2 (a.k.a. Ef-2)
• Promoter: Endogenous Eef2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nco1 (not destroyed)
• 3′ cloning site: Nhe1 (not destroyed)
• 5′ sequencing primer: ctcgctgggtcctaggct
• 3′ sequencing primer: CATCCGTTTCCTTTGTTCTGG

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry