pIS1-Actb5UTR-renilla
(Plasmid #38234)

• Depositing Lab: David Sabatini
• Publication: Thoreen et al Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083.

Backbone

• Vector backbone: pIS1
• Backbone size w/o insert (bp): 3500
• Total vector size (bp): 3600
• Modifications to backbone: The original promoter was replaced with approximately 1 kb of sequence upstream of the endogenous 5' UTR for Actb.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Actb 5'UTR / Renilla
• Alt name: Actb
• Species: M. musculus (mouse)
• Mutation: Actb 5' UTR fused to renilla ORF
• Entrez Gene: Actb (a.k.a. Actx, E430023M04Rik, beta-actin)
• Promoter: Endogenous Actb

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (destroyed during cloning)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: gtgaccttttcggtctgctc
• 3′ sequencing primer: TGGATCATAAACTTTCGAAGTCAT

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry