pMXs-IP-EGFP-LC3
(Plasmid #38195)

• Depositing Lab: Noboru Mizushima
• Publication: Hara et al J Cell Biol. 2008 May 5. 181(3):497-510.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5847
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: microtubule-associated protein 1 light chain 3 beta
• Alt name: Map1lc3b
• Alt name: LC3B
• Species: R. norvegicus (rat)
• Insert Size (bp): 423
• GenBank ID: XM_017601351.2
• Entrez Gene: Map1lc3b (a.k.a. LC3B, Map1lc3, Mpl3, zbs559)
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CAGCCCTCACTCCTTCTCTAG
• 3′ sequencing primer: GAGGAACTGCTTCCTTCACG

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry