pMXs-puro-EGFP-FAK
(Plasmid #38194)

• Depositing Lab: Noboru Mizushima
• Publication: Hara et al J Cell Biol. 2008 May 5. 181(3):497-510.

Backbone

• Vector backbone: pMXs-puro
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 6878
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PTK2 protein tyrosine kinase 2
• Alt name: FAK
• Alt name: p125FAK
• Species: M. musculus (mouse)
• Insert Size (bp): 3159
• GenBank ID: NM_007982.2
• Entrez Gene: Ptk2 (a.k.a. FADK 1, FAK, FRNK, Fadk, p125FAK)
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CAGCCCTCACTCCTTCTCTAG
• 3′ sequencing primer: AAAATTAGTCAGCCATGGGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry