pMXs-IP-EGFP-hFIP200
(Plasmid #38192)

• Depositing Lab: Noboru Mizushima
• Publication: Hara et al J Cell Biol. 2008 May 5. 181(3):497-510.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5847
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FIP200
• Alt name: focal adhesion kinase family interacting protein of 200 kD
• Alt name: RB1CC1
• Alt name: Rb1-inducible coiled coil protein 1
• Species: H. sapiens (human)
• Insert Size (bp): 4785
• GenBank ID: BC017556
• Entrez Gene: RB1CC1 (a.k.a. ATG17, CC1, FIP200, PPP1R131)
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: CAGCCCTCACTCCTTCTCTAG
• 3′ sequencing primer: GAGGAACTGCTTCCTTCACG

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry