RCIscript-GoldyTALEN
(Plasmid #38142)

• Purpose: destination vector for the Golden Gate TALEN kit, for in vitro synthesis of TALEN mRNAs
• Depositing Labs: Daniel Carlson, Stephen Ekker
• Publication: Carlson et al Proc Natl Acad Sci U S A. 2012 Oct 1.

Backbone

• Vector backbone: pBSK
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 4651
• Vector type: mRNA transcription vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GoldyTALEN
• Alt name: TALEN
• Species: Synthetic
• Insert Size (bp): 1800
• Mutation: Truncate at N and C terminous
• Promoter: T3
• Tags / Fusion Proteins:
  • FokI homodimer (C terminal on insert)
  • AcV5 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Esp31 (destroyed during cloning)
• 3′ cloning site: Esp31 (destroyed during cloning)
• 5′ sequencing primer: CGTGACCGCAATGGAGGC
• 3′ sequencing primer: CACTGCATCCATGGCAGG

Resource Information

• Supplemental Documents:
  • RCIscript-GoldyTALEN
  • RCIscript mRNA transcription
• Addgene Notes:
  • Addgene diagnostic digest
• A portion of this plasmid was derived from a plasmid made by: It is a deriviative of a plasmid (pTAL-Leu) in the TALEN kit supplied by Dan Voytas.
• Articles Citing this Plasmid:
  • 17 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer.

The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid.

For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).

For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson