pcDNA4-FLAG-Jhdm2a-H1122A
(Plasmid #38140)

• Depositing Labs: Toshinobu Nakamura, Toru Nakano
• Publication: Nakamura et al Nature. 2012 Jun 3;486(7403):415-9. doi: 10.1038/nature11093.

Backbone

• Vector backbone: pcDNA4/myc-His A
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 9100
• Modifications to backbone: "AAGCTTATGGACTACAAAGACGATGACGACAAGGGATCC" FLAG linker is inserted to HindIII/BamHI site.
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Jhdm2a-H1122A
• Alt name: Kdm3a
• Alt name: Jmjd1a
• Species: M. musculus (mouse)
• Insert Size (bp): 4000
• Mutation: protein starts at aa115; H1122A
• Entrez Gene: Kdm3a (a.k.a. 1700105C21Rik, C230043E16Rik, JHDM2a, Jmjd1, Jmjd1a, KDM2A, TGSA, Tsga)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: BGH-rev

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry