pEGFP-N1-MITF-M
(Plasmid #38131)

• Depositing Lab: Shawn Ferguson
• Publication: Roczniak-Ferguson et al Sci Signal. 2012 Jun 12;5(228):ra42.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 5963
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MITF-M
• Alt name: microphthalmia transcription factor, M variant
• Alt name: MITF variant 5
• Species: H. sapiens (human)
• Insert Size (bp): 1247
• Mutation: deleted stop codon
• GenBank ID: NM_198158.2
• Entrez Gene: MITF (a.k.a. CMM8, COMMAD, MI, MITF-A, WS2, WS2A, bHLHe32)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that while MITF isoforms 4 and 5 can both be referred to as MITF-M, this construct contains MITF isoform 5.