pEGFP-N1-TFEB
(Plasmid #38119)

• Purpose: Mammalian expression of Transcription factor EB fused to EGFP
• Depositing Lab: Shawn Ferguson
• Publication: Roczniak-Ferguson et al Sci Signal. 2012 Jun 12;5(228):ra42.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Glontech
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 6152
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TFEB
• Alt name: Transcription factor EB
• Species: H. sapiens (human)
• Insert Size (bp): 1428
• Mutation: deleted stop codon
• GenBank ID: NM_007162.2
• Entrez Gene: TFEB (a.k.a. ALPHATFEB, BHLHE35, TCFEB)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Andrea Ballabio, TIGEM, Naples, Italy
• Articles Citing this Plasmid:
  • 71 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry