Skip to main content
Addgene

pAAV-CA-FLEX-RG
(Plasmid #38043)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 38043 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CA-FLEX
  • Backbone manufacturer
    Mitsuko Watabe-Uchida
  • Backbone size w/o insert (bp) 6058
  • Total vector size (bp) 7794
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rabies virus glycoprotein
  • Alt name
    RG
  • Species
    rabies virus
  • Insert Size (bp)
    1574
  • GenBank ID
    M31046.1
  • Promoter CA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer CCTACAGCTCCTGGGCAACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Edward M. Callaway
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CA-FLEX-RG was a gift from Naoshige Uchida (Addgene plasmid # 38043 ; http://n2t.net/addgene:38043 ; RRID:Addgene_38043)
  • For your References section:

    Whole-brain mapping of direct inputs to midbrain dopamine neurons. Watabe-Uchida M, Zhu L, Ogawa SK, Vamanrao A, Uchida N. Neuron. 2012 Jun 7;74(5):858-73. 10.1016/j.neuron.2012.03.017 PubMed 22681690