Skip to main content
Addgene

E1b-GFP-Tol2
(Plasmid #37845)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37845 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    NA
  • Vector type
    Zebrafish enhancer assay vector
  • Promoter E1b

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GATGCGGGAAGAGGTGTATTAGT
  • 3′ sequencing primer AGTTCTCAGGATCGGTCGAAAT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E1b-GFP-Tol2 was a gift from Nadav Ahituv (Addgene plasmid # 37845 ; http://n2t.net/addgene:37845 ; RRID:Addgene_37845)

  • For your References section:

    Coding exons function as tissue-specific enhancers of nearby genes. Birnbaum RY, Clowney EJ, Agamy O, Kim MJ, Zhao J, Yamanaka T, Pappalardo Z, Clarke SL, Wenger AM, Nguyen L, Gurrieri F, Everman DB, Schwartz CE, Birk OS, Bejerano G, Lomvardas S, Ahituv N. Genome Res. 2012 Jun;22(6):1059-68. Epub 2012 Mar 22. 10.1101/gr.133546.111 PubMed 22442009
Related items:
Commonly requested with: