Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNG2470
(Plasmid #37837)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37837 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPD49.26
  • Backbone manufacturer
    Fire Lab
  • Backbone size w/o insert (bp) 3410
  • Total vector size (bp) 9497
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    F13D12.6(G166R)
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    3224
  • Mutation
    G166R, S168G
  • Entrez Gene
    F13D12.6 (a.k.a. CELE_F13D12.6)
  • Promoter nhx-2
  • Tag / Fusion Protein
    • YFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CGCTCTCTCGTCTCTCTCTC
  • 3′ sequencing primer CGTGTCTTGTAGTTCCCGTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNG2470 was a gift from Gary Silverman (Addgene plasmid # 37837 ; http://n2t.net/addgene:37837 ; RRID:Addgene_37837)
  • For your References section:

    A pro-cathepsin L mutant is a luminal substrate for endoplasmic-reticulum-associated degradation in C. elegans. Miedel MT, Graf NJ, Stephen KE, Long OS, Pak SC, Perlmutter DH, Silverman GA, Luke CJ. PLoS One. 2012;7(7):e40145. Epub 2012 Jul 2. 10.1371/journal.pone.0040145 PubMed 22768338