pAV1951
(Plasmid
#37832)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepPD49.26
-
Backbone manufacturerFire Lab
- Backbone size w/o insert (bp) 3410
-
Modifications to backbone
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePnhx-2mCherry
-
Insert Size (bp)711
- Promoter nhx-2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer TATTATGCTAGCATGGTGAGCAAGGGCGAGGAG
- 3′ sequencing primer ATATAAGATATCCTACTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAV1951 was a gift from Gary Silverman (Addgene plasmid # 37832 ; http://n2t.net/addgene:37832 ; RRID:Addgene_37832) -
For your References section:
A pro-cathepsin L mutant is a luminal substrate for endoplasmic-reticulum-associated degradation in C. elegans. Miedel MT, Graf NJ, Stephen KE, Long OS, Pak SC, Perlmutter DH, Silverman GA, Luke CJ. PLoS One. 2012;7(7):e40145. Epub 2012 Jul 2. 10.1371/journal.pone.0040145 PubMed 22768338