Skip to main content
Addgene

pHL 363
(Plasmid #37758)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37758 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    ColE (from pZ system) + AmpR
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 5200
  • Vector type
    Synthetic Biology ; E. coli

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    pLar_rpoS_gfp
  • Species
    E. coli
  • Insert Size (bp)
    1700
  • Promoter pLar
  • Tag / Fusion Protein
    • gfp (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer ctcatgagcggatacat atttgaa
  • 3′ sequencing primer cgcggatcc TGAGCGGATACATATTTGAATGTA
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pLtet_dsrA_pLac_araC
  • Species
    E. coli
  • Insert Size (bp)
    1400
  • Promoter Ptet and pLac
  • Tag / Fusion Protein
    • none

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site Apa1 (not destroyed)
  • 5′ sequencing primer GCTGGGATTA CACATGGCAT GGAT
  • 3′ sequencing primer agctgatacc gctcgccgca gccgaacg
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gfp is from pTak 102

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL 363 was a gift from Han Lim (Addgene plasmid # 37758 ; http://n2t.net/addgene:37758 ; RRID:Addgene_37758)

  • For your References section:

    Direct comparison of small RNA and transcription factor signaling. Hussein R, Lim HN. Nucleic Acids Res. 2012 May 22. 10.1093/nar/gks439 PubMed 22618873
Related items: