pHL 233
(Plasmid #37754)

• Depositing Lab: Han Lim
• Publication: Hussein et al Nucleic Acids Res. 2012 May 22.

Backbone

• Vector backbone: ColE (from pZ system) + AmpR
• Backbone size w/o insert (bp): 2000
• Total vector size (bp): 5300
• Vector type: Synthetic Biology ; E. coli

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ptet_ompC_gfp
• Species: E. coli
• Insert Size (bp): 1800
• Promoter: ptet
• Tag / Fusion Protein:
  • gfp (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AatII (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: ctcatgagcggatacat atttgaa
• 3′ sequencing primer: cgcggatcc TGAGCGGATACATATTTGAATGTA

Gene/Insert 2

• Gene/Insert name: pLac_st7 TetR_mCherry
• Insert Size (bp): 1500
• Promoter: pLac
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (destroyed during cloning)
• 3′ cloning site: Apa1 (not destroyed)
• 5′ sequencing primer: GCTGGGATTA CACATGGCAT GGAT
• 3′ sequencing primer: agctgatacc gctcgccgca gccgaacg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: gfp is from pTak 102 mCherry is from Tsein Lab TetR is from pjm31

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry