Skip to main content
Addgene

pHL1530
(Plasmid #37569)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37569 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pZ with ColE origin
  • Backbone manufacturer
    Lim Lab
  • Modifications to backbone
    Plasmid modified from Rolf Lutz and Hermann Bujard, 1997
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GFP
  • Alt name
    green fluorescent protein
  • Species
    A. victoria
  • Insert Size (bp)
    717
  • Mutation
    start codon removed
  • Promoter pLlacO-1
  • Tag / Fusion Protein
    • glgC leader region (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCATGA GCGGATACAT ATTTGAA
  • 3′ sequencing primer cgcggatcc AAGGCCATCCGTCAGGATGGCCTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TetR
  • Promoter pConNoHind

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GCTGGGATTA CACATGGCAT GGAT
  • 3′ sequencing primer ccggaattc ACTGCTCACA AGAAAAAAGG CACG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    CsrA
  • Alt name
    carbon storage regulator
  • Species
    E. coli
  • Promoter pConNoHind

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer ggccaag CTT TAATC GTACAGGGTA GTACAAATA
  • 3′ sequencing primer AGCTGATACC GCTCGCCGCA GCCGAACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL1530 was a gift from Han Lim (Addgene plasmid # 37569 ; http://n2t.net/addgene:37569 ; RRID:Addgene_37569)
  • For your References section:

    Rapid and robust signaling in the CsrA cascade via RNA-protein interactions and feedback regulation. Adamson DN, Lim HN. Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):13120-5. doi: 10.1073/pnas.1308476110. Epub 2013 Jul 22. 10.1073/pnas.1308476110 PubMed 23878244