Skip to main content
Addgene

pHL600
(Plasmid #37563)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37563 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pZ with p15a origin
  • Backbone manufacturer
    Lim Lab
  • Modifications to backbone
    Plasmid modified from Rolf Lutz and Hermann Bujard, 1997
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CsrB
  • Species
    E. coli
  • Insert Size (bp)
    369
  • Entrez Gene
    csrB (a.k.a. b4408, ECK2787, JWR0062)
  • Promoter pLtetO-1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CAGTCATAGCCGAATAGCCT
  • 3′ sequencing primer ccggaattc ACTGCTCACA AGAAAAAAGG CACG
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CsrA
  • Species
    E. coli
  • Insert Size (bp)
    186
  • Entrez Gene
    csrA (a.k.a. b2696, ECK2691, zfiA)
  • Promoter pLlacO-1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAGTCATAGCCGAATAGCCT
  • 3′ sequencing primer ccggaattc ACTGCTCACA AGAAAAAAGG CACG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL600 was a gift from Han Lim (Addgene plasmid # 37563 ; http://n2t.net/addgene:37563 ; RRID:Addgene_37563)

  • For your References section:

    Rapid and robust signaling in the CsrA cascade via RNA-protein interactions and feedback regulation. Adamson DN, Lim HN. Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):13120-5. doi: 10.1073/pnas.1308476110. Epub 2013 Jul 22. 10.1073/pnas.1308476110 PubMed 23878244
Related items:
Commonly requested with: