pLenti-tkd2MetGFP
(Plasmid
#37562)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37562 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCMV GFP Puro
-
Backbone manufacturerEric Campeau Addgene Plasmid 17448
- Backbone size w/o insert (bp) 8608
- Total vector size (bp) 9324
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMET
-
SpeciesH. sapiens (human)
-
Insert Size (bp)704
-
Mutationonly contains cytoplasmic domain amino acids L1157-S1390
-
Entrez GeneMET (a.k.a. AUTS9, DA11, DFNB97, HGFR, RCCP2, c-Met)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gacgccatccacgctgttttgacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-tkd2MetGFP was a gift from David Rimm (Addgene plasmid # 37562 ; http://n2t.net/addgene:37562 ; RRID:Addgene_37562)