pBAD Strep His6 TEV LIC cloning vector (8HR)
(Plasmid #37505)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: 8-series E. coli arabinose expression vectors (unpublished)

Backbone

• Vector backbone: pBAD
• Backbone size (bp): 5729
• Vector type: Bacterial Expression
• Promoter: araBAD arabinose
• Tags / Fusion Proteins:
  • His6 (N terminal on backbone)
  • strep (N terminal on backbone)
  • TEV recognition (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Low Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ARA F (5'cattctgtaacaaagcggga)
• 3′ sequencing primer: ARA Rv (5'ctgttttatcagaccgcttc)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted via LIC cloning.

8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.

8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins.

To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through