pNCMV 8E6
(Plasmid #37460)

• Purpose: Expression of HPV 8E6 in mammalian cells
• Depositing Lab: Karl Munger
• Publication: Spangle et al J Virol. 2012 May 2.

Backbone

• Vector backbone: CMV bam neo
• Backbone size w/o insert (bp): 6550
• Total vector size (bp): 7100
• Modifications to backbone: Flag/HA tag-containing linker added at BamHI site.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HPV 8E6
• Alt name: 8E6
• Alt name: E6
• Species: HPV
• Insert Size (bp): 542
• GenBank ID: AAD47251.1 Uniprot: P06428
• Promoter: CMV
• Tags / Fusion Proteins:
  • Flag (N terminal on backbone)
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (destroyed during cloning)
• 5′ sequencing primer: Bglob_intron_F (ctggtcatcatcctgccttt)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 8E6 template was given to us by Harold Pfister who originally cloned the HPV8 genome. (J. Virology 1986, Pfister H. et al.)