pNCMV 6bE6
(Plasmid
#37457)
-
PurposeExpression of HPV 6bE6 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCMV bam neo
- Backbone size w/o insert (bp) 6550
- Total vector size (bp) 7081
-
Modifications to backboneFlag/HA tag-containing linker added at BamHI site.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHPV 6bE6
-
Alt name6bE6
-
Alt nameE6
-
SpeciesHPV
-
Insert Size (bp)530
-
GenBank IDNC_001355 NP_040296.1
-
Entrez GeneE6 (a.k.a. HPV6bgp1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Flag (N terminal on backbone)
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer Bglob_intron_F (ctggtcatcatcctgccttt) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNCMV 6bE6 was a gift from Karl Munger (Addgene plasmid # 37457 ; http://n2t.net/addgene:37457 ; RRID:Addgene_37457) -
For your References section:
Activation of cap dependent translation by mucosal Human Papillomavirus E6 proteins is dependent on the integrity of the LXXLL binding motif. Spangle J, Ghosh-Choudhury N, Munger K. J Virol. 2012 May 2. 10.1128/JVI.00487-12 PubMed 22553330