Skip to main content
Addgene

pNCMV 11E6
(Plasmid #37455)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37455 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CMV bam neo
  • Backbone size w/o insert (bp) 6550
  • Total vector size (bp) 7080
  • Modifications to backbone
    Flag/HA tag-containing linker added at BamHI site.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HPV 11E6
  • Alt name
    E6
  • Species
    HPV
  • Insert Size (bp)
    530
  • Promoter CMV
  • Tags / Fusion Proteins
    • Flag (N terminal on backbone)
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer Bglob_intron_F (ctggtcatcatcctgccttt)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNCMV 11E6 was a gift from Karl Munger (Addgene plasmid # 37455 ; http://n2t.net/addgene:37455 ; RRID:Addgene_37455)
  • For your References section:

    Activation of cap dependent translation by mucosal Human Papillomavirus E6 proteins is dependent on the integrity of the LXXLL binding motif. Spangle J, Ghosh-Choudhury N, Munger K. J Virol. 2012 May 2. 10.1128/JVI.00487-12 PubMed 22553330