Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNCMV 16E6no*
(Plasmid #37454)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37454 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CMV bam neo
  • Backbone size w/o insert (bp) 6550
  • Total vector size (bp) 7092
  • Modifications to backbone
    Flag/HA tag-containing linker added at BamHI site.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HPV 16E6no*
  • Alt name
    HPV 16E6
  • Alt name
    HpV16gp1
  • Alt name
    E6
  • Species
    HPV
  • Insert Size (bp)
    542
  • Mutation
    V42L
  • GenBank ID
    NC_001526.2
  • Entrez Gene
    E6 (a.k.a. HpV16gp1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Flag (N terminal on backbone)
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer Bglob_intron_F (ctggtcatcatcctgccttt)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNCMV 16E6no* was a gift from Karl Munger (Addgene plasmid # 37454 ; http://n2t.net/addgene:37454 ; RRID:Addgene_37454)
  • For your References section:

    Activation of cap dependent translation by mucosal Human Papillomavirus E6 proteins is dependent on the integrity of the LXXLL binding motif. Spangle J, Ghosh-Choudhury N, Munger K. J Virol. 2012 May 2. 10.1128/JVI.00487-12 PubMed 22553330