pTK21
(Plasmid #37396)

• Depositing Lab: Iain Cheeseman
• Publication: Kiyomitsu et al Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ran
• Species: H. sapiens (human)
• Insert Size (bp): 651
• Mutation: T24N
• Entrez Gene: RAN (a.k.a. ARA24, Gsp1, TC4)
• Tags / Fusion Proteins:
  • mCherry (N terminal on insert)
  • TEV (N terminal on insert)
  • S-tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing result exactly matches the full plasmid sequence provided by the depositing laboratory; however, when these sequences are compared to GenBank ID NP_006316.1 there appears to be a T24N mutation.