pCB168
(Plasmid #37389)

• Depositing Lab: Iain Cheeseman
• Publication: Kiyomitsu et al Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440.

Backbone

• Vector backbone: pBABE
• Modifications to backbone: This contains a blasticidin resistance gene for selection in eukaryotic cells.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dynein cytoplasmic 1 intermediate chain 1
• Alt name: DYNC1I1
• Alt name: DNCIC1
• Species: H. sapiens (human)
• Insert Size (bp): 1887
• GenBank ID: AAH32945.1
• Entrez Gene: DYNC1I1 (a.k.a. DNCI1, DNCIC1)
• Tags / Fusion Proteins:
  • GFP (N terminal on insert)
  • TEV (N terminal on insert)
  • S-tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: IMAGE, 4801387
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry