pCB163
(Plasmid #37388)

• Depositing Lab: Iain Cheeseman
• Publication: Kiyomitsu et al Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440.

Backbone

• Vector backbone: pBABE
• Modifications to backbone: This contains a blasticidin resistance gene for selection in eukaryotic cells.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Dynactin 2
• Alt name: p50
• Alt name: DCTN2
• Species: H. sapiens (human)
• Insert Size (bp): 1206
• Mutation: A7P
• Entrez Gene: DCTN2 (a.k.a. DCTN50, DYNAMITIN, HEL-S-77, RBP50)
• Tags / Fusion Proteins:
  • TEV (N terminal on insert)
  • S-tag (N terminal on insert)
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: IMAGE, 4303142
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results identified single nucleotide mismatches at bp# 2273 & 2347 when compared to the full plasmid sequence provided by the depositing laboratory. The mismatch at bp#2273 causes A7P mutation in the DCTN2 seqeuence.