pIC389
(Plasmid #37387)

• Depositing Lab: Iain Cheeseman
• Publication: Kiyomitsu et al Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440.

Backbone

• Vector backbone: pBABE
• Modifications to backbone: This contains a blasticidin resistance gene for selection in eukaryotic cells.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LGN
• Alt name: GPSM2
• Species: H. sapiens (human)
• Insert Size (bp): 963
• Mutation: deleted amino acid 1-364 and 524
• GenBank ID: NP_037428.3
• Entrez Gene: GPSM2 (a.k.a. CMCS, DFNB82, LGN, PINS)
• Tags / Fusion Proteins:
  • GFP (N terminal on insert)
  • TEV (N terminal on insert)
  • S-tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ORIGENE, SC111910

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results have confirmed that bp# 2734-2736 in the full plasmid sequence provided by the depositing laboratory are deleted in this plasmid, resulting in the deletion of amino acid 524 in the LGN sequence.