Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIC389
(Plasmid #37387)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37387 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBABE
  • Modifications to backbone
    This contains a blasticidin resistance gene for selection in eukaryotic cells.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LGN
  • Alt name
    GPSM2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    963
  • Mutation
    deleted amino acid 1-364 and 524
  • GenBank ID
    NP_037428.3
  • Entrez Gene
    GPSM2 (a.k.a. CMCS, DFNB82, LGN, PINS)
  • Tags / Fusion Proteins
    • GFP (N terminal on insert)
    • TEV (N terminal on insert)
    • S-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ORIGENE, SC111910

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results have confirmed that bp# 2734-2736 in the full plasmid sequence provided by the depositing laboratory are deleted in this plasmid, resulting in the deletion of amino acid 524 in the LGN sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIC389 was a gift from Iain Cheeseman (Addgene plasmid # 37387 ; http://n2t.net/addgene:37387 ; RRID:Addgene_37387)
  • For your References section:

    Chromosome- and spindle-pole-derived signals generate an intrinsic code for spindle position and orientation. Kiyomitsu T, Cheeseman IM. Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440. 10.1038/ncb2440 PubMed 22327364