pSR-puro-Mff1 shRNA
(Plasmid
#37247)
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepSuper-Retro-Puro
-
Backbone manufacturerOligoEngine
- Backbone size w/o insert (bp) 6350
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMff1
-
gRNA/shRNA sequenceAACGCTGACCTGGAACAAGGA
-
SpeciesH. sapiens (human)
-
Entrez GeneMFF (a.k.a. C2orf33, EMPF2, GL004)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pLXSN 5' (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR-puro-Mff1 shRNA was a gift from Christopher Counter & David Kashatus (Addgene plasmid # 37247 ; http://n2t.net/addgene:37247 ; RRID:Addgene_37247) -
For your References section:
RALA and RALBP1 regulate mitochondrial fission at mitosis. Kashatus DF, Lim KH, Brady DC, Pershing NL, Cox AD, Counter CM. Nat Cell Biol. 2011 Aug 7;13(9):1108-15. doi: 10.1038/ncb2310. 10.1038/ncb2310 PubMed 21822277