pET Trx His6 LIC cloning vector (2Tc-T)
(Plasmid #37239)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: 2-series C-terminal fusion vectors for E. coli expression (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 5121
• Vector type: Bacterial Expression
• Promoter: T7
• Tags / Fusion Proteins:
  • Thioredoxin (Trx) (C terminal on backbone)
  • His6 (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Low Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: T7 promoter

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

2Tc-T has a TEV-cleavable C-terminal thioredoxin (Trx) tag to enhance solubility, as well as a His6 tag to ease purification.

To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers.

Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3'

Reverse - 5'GGATTGGAAGTAGAGGTTCTC3'

Linearize the plasmid with HpaI and gel purify.

When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/