-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerEMD bioscience
- Backbone size w/o insert (bp) 5420
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameTIF4631
-
Alt nameeIF4G1
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneTIF4631 (a.k.a. YGR162W)
- Promoter T7
-
Tags
/ Fusion Proteins
- GST (N terminal on insert)
- His6 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer pET Upstream (ATGCGTCCGGCGTAGA) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCDC33
-
Alt nameeIF4E
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneCDC33 (a.k.a. YOL139C, TIF45)
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer DuetUP2 (TTGTACACGGCCGCATAATC)
- 3′ sequencing primer T7-term (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-DUET-GST-eIF4G1-His6, eIF4E was a gift from Jon Lorsch (Addgene plasmid # 37232 ; http://n2t.net/addgene:37232 ; RRID:Addgene_37232) -
For your References section:
The 5'-7-methylguanosine cap on eukaryotic mRNAs serves both to stimulate canonical translation initiation and to block an alternative pathway. Mitchell SF, Walker SE, Algire MA, Park EH, Hinnebusch AG, Lorsch JR. Mol Cell. 2010 Sep 24;39(6):950-62. 10.1016/j.molcel.2010.08.021 PubMed 20864040