mZO1-2 shRNA
(Plasmid
#37216)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLL5.0
- Backbone size w/o insert (bp) 7700
- Total vector size (bp) 7800
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse ZO-1 shRNA
-
Alt nameZO-1
-
gRNA/shRNA sequenceGAACAGAGCTGAACAGTTA
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_009386
-
Entrez GeneTjp1 (a.k.a. ZO1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer mU6-F (ATATCCCTTGGAGAAAAGCCTT) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mZO1-2 shRNA was a gift from Alan Fanning (Addgene plasmid # 37216 ; http://n2t.net/addgene:37216 ; RRID:Addgene_37216)