pDonor MCS Rosa26
(Plasmid #37200)

• Depositing Lab: Charles Gersbach
• Publication: Perez-Pinera et al Nucleic Acids Res. 2012 Apr 1;40(8):3741-52. Epub 2011 Dec 14.

Backbone

• Vector backbone: pZDonor AAVS1
• Backbone manufacturer: Sigma
• Total vector size (bp): 4524
• Modifications to backbone: mouse Rosa26 targeting arms were PCR amplified and cloned in as described in the manuscript.
• Vector type: Genomic targeting - zinc finger

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Rosa26 left targeting arm
• Species: M. musculus (mouse)
• Insert Size (bp): 796

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: M13_pUC-fwd

Gene/Insert 2

• Gene/Insert name: MCS

Gene/Insert 3

• Gene/Insert name: Rosa26 right targeting arm
• Insert Size (bp): 815

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: NA
• 3′ sequencing primer: M13_pUC-rev

Resource Information

• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich.