Skip to main content
Addgene

pTAL13
(Plasmid #37186)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37186 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA 3.1 (-)
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 8100
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)
  • Tag / Fusion Protein
    • FokI (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TAL-F1: ttggcgtcggcaaacagtgg
  • 3′ sequencing primer TAL-R2: GGCGACGAGGTGGTCGTTGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expression of the TAL-FokI homodimer in mammalian cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTAL13 was a gift from Adam Bogdanove (Addgene plasmid # 37186 ; http://n2t.net/addgene:37186 ; RRID:Addgene_37186)

  • For your References section:

    Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687
Related items: