-
Purpose(Empty Backbone) Destination vector for Voytas Golden Gate TALEN assembly incorporating a CAG promoter for mammalian expression and a T7 promoter for synthesis of TALEN mRNA. Uses homodimeric FokI domains.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepDIRECT
-
Backbone manufacturerCLONTECH
- Backbone size (bp) 4810
-
Vector typeMammalian Expression
- Promoter CAG
-
Tag
/ Fusion Protein
- FokI nuclease (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TAL_F1 (ttggcgtcggcaaacagtgg)
- 3′ sequencing primer TAL_R2 (ggcgacgaggtggtcgttg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe TALEN destination cassette is derived from pTAL4, which is included in the Voytas Lab Golden Gate TALEN Kit.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-T7-TALEN(Sangamo)-Destination was a gift from Pawel Pelczar (Addgene plasmid # 37184 ; http://n2t.net/addgene:37184 ; RRID:Addgene_37184) -
For your References section:
Mouse genome engineering using designer nucleases. Hermann M, Cermak T, Voytas DF, Pelczar P. J Vis Exp. 2014 Apr 2;(86). doi: 10.3791/50930. 10.3791/50930 PubMed 24747757
Map uploaded by the depositor.
