Skip to main content
Addgene

pET PPL His6 LIC cloning vector (2J-T)
(Plasmid #37182)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37182 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 4861
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tags / Fusion Proteins
    • PPL (N terminal on backbone)
    • His6 (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.

2J-T has a TEV-cleavable N-terminal His6 fusion tag. This is preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET PPL His6 LIC cloning vector (2J-T) was a gift from Scott Gradia (Addgene plasmid # 37182 ; http://n2t.net/addgene:37182 ; RRID:Addgene_37182)