pAAV-Ef1a-FAS-ChETA-TdTomato-WPRE-pA
(Plasmid #37089)

• Purpose: Expresses ChETA-tdTomato in cells lacking Cre (Cre-Off, flanked by alternative lox FAS sites), for optogenetic excitation
• Depositing Lab: Bernardo Sabatini
• Publication: Saunders et al Front Neural Circuits. 2012 Jul 27;6:47. doi: 10.3389/fncir.2012.00047. eCollection 2012.

Backbone

• Vector backbone: pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA
• Backbone manufacturer: K. Deisseroth Lab
• Backbone size w/o insert (bp): 5435
• Total vector size (bp): 7808
• Vector type: AAV, Cre/Lox ; Cre-Off

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ChETA-TdTomato
• Species: Synthetic
• Insert Size (bp): 2373
• Promoter: EF1a
• Tag / Fusion Protein:
  • TdTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc1 (not destroyed)
• 3′ cloning site: Nhe1 (not destroyed)
• 5′ sequencing primer: CTTCCATTTCAGGTGTCGTG
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Karl Deisseroth Lab, Stanford Univ.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry