pAAV-Ef1a-FAS-NpHR3.0-eYFP-WPRE-pA
(Plasmid #37088)

• Purpose: Expresses NpHR3.0-EYFP in cells lacking Cre (Cre-Off, flanked by alternative lox FAS sites), for optogenetic inhibition
• Depositing Lab: Bernardo Sabatini
• Publication: Saunders et al Front Neural Circuits. 2012 Jul 27;6:47. doi: 10.3389/fncir.2012.00047. eCollection 2012.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA
• Backbone manufacturer: K. Deisseroth Lab
• Backbone size w/o insert (bp): 5435
• Total vector size (bp): 7118
• Vector type: AAV, Cre/Lox ; Cre-Off

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NpHR3.0-EYFP
• Species: Synthetic
• Insert Size (bp): 1683
• Promoter: EF1a
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc1 (not destroyed)
• 3′ cloning site: Nhe1 (not destroyed)
• 5′ sequencing primer: CTTCCATTTCAGGTGTCGTG
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Karl Deisseroth Lab, Stanford Univ.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry